Anonymous
Anonymous asked in Science & MathematicsBiology · 1 month ago

Transcribing DNA strand to mRNA?

Given the following Coding DNA strand, match the correct strands. Make sure to keep the 5' and 3' orientation.

3'- CGTGTAGCGGTCCGGTAATTATAGTAAAAGCCACCAGCGGTAGCGTTA- 5'

I transcribe the DNA into "GCACAUCGCCAGGCCAUUAAUAUCAUUUUCGGUGGUCGCCAUCGCAAU" but that is not an answer choice so I'm not sure if I'm wrong or its an error on part of my professor.

1 Answer

Relevance
  • 1 month ago
    Favorite Answer

    o The "coding strand" has the same sequence and directionality as the RNA.

    o Always mark the 5' and 3' ends.  Always.

    You should be looking for something that starts with

    5'-AUUGCGAUG...

    • Commenter avatarLogin to reply the answers
Still have questions? Get your answers by asking now.