Anonymous
Anonymous asked in Computers & InternetProgramming & Design · 1 month ago

Write a Python program that translates a DNA sequences into a protein sequences.?

In other words, your script should convert all codons into

amino acids. 

For this problem, the input file, called "fasta.txt", is

in FASTA format with at least one sequence. For example if the input

file contains:

>human

ATGAGGTACGCCGCCAGAAC

TATGATCTAGCTAGCATCCG

>chimp

ATGACGTACGCCGCCAGAAG

GCATCGCCAGCAGCATCG

>monkey

ATGACGTAGTAGTACGACCA

GCAGCGATCGATGCATCCA

Then the output printed to the screen should be:

human MRYAARTMI_LAS

chimp MTYAARRHRQQH

monkey MT__YDQQRSMHP

You may NOT assume that the sequence length is always a multiple of 3

or that sequences will have the same length. Use the codon2aa map given

in the code examples above. You will first have to transcribe the DNA

sequence to RNA before being able to use it.

2 Answers

Relevance
  • EddieJ
    Lv 7
    1 month ago

    Meat provides complete proteins but vegans don't eat meat so they are advised to eat rice & beans, which combine to provide a complete protein.  But quinoa is one plant-based food that contains all the needed amino acids.

    • Login to reply the answers
  • 1 month ago

    Do your own homework.

    • Login to reply the answers
Still have questions? Get your answers by asking now.