Anonymous
Anonymous asked in Science & MathematicsBiology · 8 years ago

DNA molecule question (living environment)?

Okay, so theres 2 species:

Species 1: TACCGGATTAGTTATGCCGGATCG

Species 2: TACGGATGCCGGATCGGAAATTCG

then it says:

"A biological catalyst that recognises the CCGG site is used to cut the DNA molecules into pieces. The catalyst cuts the DNA btwn the C and G of the site.

My question: Do i only cut between C and G when it's CCGG or can it also be separated if it's just CG ?

3 Answers

Relevance
  • 8 years ago
    Favorite Answer

    If the catalyst recognizes only the CCGG site, then it will only cut at a CCGG site. The fact that it happens to cut between the C and G doesn't change its recognition site.

    Source(s): I'm a biology student.
    • Commenter avatarLogin to reply the answers
  • Anonymous
    8 years ago

    It will only cut at CCGG sites, and at these sites it will cut between the C and G. It will not cut anywhere with a CG in it.

    • Commenter avatarLogin to reply the answers
  • 4 years ago

    Wait, for no longer mandatory interior the test -- i theory it become a end for the advice it particularly is to be gathered. you could choose guidance on a thank you to apply the technologies, top? And in case you have no longer gathered the advice, how are you meant to end? paper chromatography: separates molecules kangaroo w/o placenta: food ~~~~~~~~~~~ end results of the guy below me. For the stomate/guard cellular question, for the third bullet, there is completely one possible answer. - effective to take in extra moisture, discovered on soil and grass For the 2d, you could've placed gas replace or water absorption. yet for the 1st, what function become it? Oh, and the bacteria temperature become that an extra advantageous temperature reasons bigger reproductive quotes. It would not be that distinctive species reproduce at particular temperatures simply by fact maximum have been in a position to reproduce at 20 distinctive tiers or temperatures. (C)

    • Commenter avatarLogin to reply the answers
Still have questions? Get your answers by asking now.