DNA molecule question (living environment)?

Okay, so theres 2 species: Species 1: TACCGGATTAGTTATGCCGGATCG Species 2: TACGGATGCCGGATCGGAAATTCG then it says: "A biological catalyst that recognises the CCGG site is used to cut the DNA molecules into pieces. The catalyst cuts the DNA btwn the C and G of the site. My question: Do i only cut between C... show more Okay, so theres 2 species:
Species 1: TACCGGATTAGTTATGCCGGATCG
Species 2: TACGGATGCCGGATCGGAAATTCG
then it says:
"A biological catalyst that recognises the CCGG site is used to cut the DNA molecules into pieces. The catalyst cuts the DNA btwn the C and G of the site.
My question: Do i only cut between C and G when it's CCGG or can it also be separated if it's just CG ?
3 answers 3