Lv 31,184 points

?

Favorite Answers17%
Answers253

Full time college student with an Associates degree in Early Childhood Education. I also have a full time job as an assistant teacher in a daycare. I love helping others through my words :)

  • Charlie and the chocolate factory?

    If you were asked to create another character to Charlie and the Chocolate Factory, who would it be, why, and where would they fit into the story, you can change it around a little but so far I have a little creative block trying to think of one.

    2 AnswersMovies7 years ago
  • Other Countries Views on Sexuality and Gender?

    What are some countries views of Sexuality and Gender across the world?

    How women or men are viewed?

    Pornography?

    etc.

    2 AnswersOther - Cultures & Groups8 years ago
  • College bio lab question (genetics)?

    Usually I am fairly well at genetics however this question is alittle difficult for me to understand, any help would be great!

    Peas homozygous dominant for position (axial) and color (yellow) are crossed with those recessive for these traits. Show work up to F2 (long method).

    1 AnswerBiology8 years ago
  • Genocide Proj ideas.......?

    In my genocide class we have to create our own genocide.... it can be anything from real life ideas to a pen and pencil fighting it out... Im just out of ideas... if you can list as many as you could think of it could really help me with this project. Thanks :)

    1 AnswerHistory9 years ago
  • My Fish gave birth today?

    I didnt know i thought she was just reallyy fat because the store lady told us it was all girls we got, apparently 1 mistake.

    Now she gave birth today and I was told to seperate them but I cant because we dont have anywhere else to put them and they are tropical fish so they need heat to survive. What im finding wierd is everyone is saying that you need to seperate because the mother will eat them but they were together all day today and none have been missing, so far 8 babies have been born. I also dont know how to see when they are done giving birth?

    7 AnswersFish10 years ago
  • Im worried about my dad?

    Im worried for his future. He doesn't eat healthy enough, he never goes to the doctor/dentist, or ever tries to exercise alittle. It scares me because im 16 and I want to see my dad live to see me get married, have kids etc. How can I help him? Ive already tried to talk to him but he wont admit it. He also wont admit that he eats a full box of cookies or a half gallon of ice cream the first day he gets it. Also, My mom is already worried that he might have diabetes because my grandma is a diabetic.

    3 AnswersFamily10 years ago
  • Japanese anything that includes/starts with the letter Q or X?

    for a project, this is what i have for the other letters:

    A: Anime

    B: Bushidu

    C: Culture + Rituals

    D: Death

    E: Education

    F: Focus

    G: Giesha

    H: homes in tokyo

    I: Isolation

    J: Japan

    K: Karate

    L: Land of the rising sun

    M: Meiji Era

    N: Noh

    O: Ocean

    P: Problems

    Q:

    R: Respect

    S: Shinto

    T: Tokogawa Era

    U: Univercitys

    V: VOC schools

    W: World war II

    X:

    Y: kyogen

    Z: Zen

    4 AnswersOther - Education10 years ago
  • Warcraft III online help?

    I can play single player and campain but when I click on the battle.net button it tells me that I dont have latest version? CONFUSION! this just happened by the way because i used to play online and of course it may be thats its been sitting on my desktop for a month? im not all techy so I need alittle help here, if you could explain why its saying this and where i can get a latest version or whatever its telling me to do would be nice help thanks! (this is my brothers game and i only go on my brothers computer to play lolz so i dont knoww much)

    1 AnswerVideo & Online Games10 years ago
  • Poll: Do they pick favorites?

    Just want to know if im right by taking a poll.

    My music teacher decided to give us a midterm, Im an excellent player, 1st flute untill after the midterms ended. I got a 97 on my midterm, and my stand partner got a 98. Now I thought "ok no big deal he wont move me." Instead he moves me to second flute, and on top of that he moves my stand partner up to first chair. This made no sense to me, and I felt like I was being "unfavorited" by the music staff. I talked to the teacher one day after class and he asked if I wanted to see the scores. (I ALREDY KNEW THEM!) He was being very rude in my opinion and I just walked away. Now Im stuck with a stand partner who cannot play music! I dont know why she even took up the flute!

    Vote yes or no and maybe a backup reason on if I was being "unfavorited" by the staff or somthing like that(but i cant find the word im looking for)

    3 AnswersPolls & Surveys10 years ago
  • Tips for using crutches?

    1st time crutch user lolz and in high school

    so its kinda wierd not knowing what to do...

    I looked like i didnt kno anything today at

    school and my upper arms hurt right where

    the armrest was... any tips to make that pain

    go away?? also any tips on how to walk

    easier??

    1 AnswerInjuries1 decade ago
  • What Point of view is sleeping beauty told from?

    I have to rewrite a childrens story for english and I chose sleeping beauty because my name is the same as hers.

    Im just having trouble in identifying who's point of view it's written in. Im assuming the 3 fairies, but some can argue it's the authors point of view.

    And im also taking a poll:

    if you were to rewrite a children's story which story would it be and why?

    1 AnswerHomework Help1 decade ago
  • Can my goldfish live in a tropical tank?

    My poor little goldfish lost his buddy today and now he looks all too lonely just staying in one spot all day and moving to the other side to repeat... he looks so sad and I think he'd like some friends.

    My mom won't allow me to buy another(even though they are like 70 cents or something?) she blames me for killing his buddy but I took care of him, probably just old age (it was a couple years old?)

    anyways in the tank I have 4 zebra danios, 2 mollies, 1 redwag swordtail, 1 redtail shark, and 2 some kind of invisable round fish about 2 inches(maybe 1 inch) wide in length. They all are in a 20 gallon tank and ive had them for a while. Can they harm a goldfish if i put him in there???

    TROPICAL TANK, 20 gallons, 10 fish so far(we are going to get a bigger tank soon)

    6 AnswersFish1 decade ago
  • Colleges that offer music and science (i put more specifics this time)?

    I want to major in chemistry and music when I go to college. Any recommendations? If you can, can you give me a few to choose from, and if you can a website would be nice?

    Extra things:

    -preferably a public university

    -in maybe pennsylvania, Connecticut, NY, ohio, maryland

    -Music major in performance

    -Please nothing too over the top like yale/harvard/princeton

  • How can I find Closure?

    My grandpa died 3 years ago today and I can't seem to forgive myself.

    The last week he was in the hospital I got a number to call him and it had his room number, times, everything. I had plenty of chances to call him and now I regret not calling him. My reason was because I didn't want to hear him sick and coughing on the phone.. I wanted to make sure that if he did in fact die.. I would remember his voice in a nice not coughing not sick way. I regret my decision.

    I also regret not visiting him. He lives across the country in cali and I was doing everything I could to possible get a ticket and fly over there to see him. It didn't happen because I couldn't get the ticket in time to fly over there and I almost was going to go.

    The day he died, I was on the phone with my grandma and she was talking about how it was really bad.. blah blah blah u know how it is.. the horrible feeling.. and i hear a doctor saying in the background that he has just passed. Do u think it was supposed to happen that way? How he dies the first day that I call and check if hes okay?

    His last words were for me.. not his daughter. She didn't hear about his death until she landed in cali. she promised half the ashes. its been 3 years and I feel that I could have done something to get the ashes she promised.

    How can I find closure when I feel like this? Ive felt like this for 3 years and the only thing i do to feel better is write letters o my grandpa and keep his memories alive. Am i doing the right thing? what else am i supposed to do? Im just 16 and I don't know how to find "closure"

    2 AnswersFamily1 decade ago
  • Why am I bleeding while going #2?

    The #2 is bloody and its diarrhea...

    It really hurts when I go to the bathroom and worst of all I can feel when its about to happen. Stomach pains everywhere like im about to throw up and I feel dizzy as well. Usually I have to literally RUN to the bathroom to get rid of the pains.

    WHAT could be wrong with me?

    The doctor ran blood tests on everything but didn't find anything wrong. Worst thing is I DONT BELIEVE HIM. He never explained to me what could be wrong and just ran a buncha blood tests. Last year It happened in the summer and its happening again in the summer. Why is it only happening in the summer? IDK! But I WANT THE PAIN TO STOP.

    I also don't wanna tell my mom becuz im having a good summer and I don't want to ruin it by going to the hospital.

    The first time I had this I bled 6 times

    Sometimes bleed 2 times every week

    Today it had happened 2 times so far and it was in an hour between each bleeding.

    ON TOP OF THIS I have had my menstrual cycle since January 12th

    If it matters at all... im 16?

    1 AnswerWomen's Health1 decade ago
  • My sweet 16 is on saturday?

    I don't know how everything happens like I plan on making an entrance, then I think

    you would eat?, then I think we might i don't know..... I don't know where to go from there.

    Im dancing with my father, but i don't know what time. I want my friends to say speeches,

    I also don't know what time, and lastly I have my 16 candles and dancing of course. But

    how do they all fit in together?

    How did your sweet 16 go, or how did your friends turn out? what did you or they do

    first? second? etc.

    2 AnswersFamily1 decade ago
  • Bio Chart, bio teacher never taught me this?!?!?

    My teacher never taught me this:

    Complete the chart below by putting a check mark underneath where it belongs:

    Trait .......................monera ..................protists ............fungi ..........Plants ...........Animals

    prokaryotic

    eukaryotic

    unicellular

    multicellular

    autotrophic

    heterotrophic

    3 AnswersBiology1 decade ago
  • DNA Question, My teacher never taught me this and is putting it on the final!?!?

    My teacher is such a jerk for not teaching me this and then putting it on the final:

    Study Guide #7

    Question #248

    Complete the following:

    TACTACGGGACACTCGATAAT

    DNA Strand 1

    Complementary DNA Strand

    mRNA strand (based on strand 1)

    Amino acids

    3 AnswersBiology1 decade ago
  • I've had my period since January 3rd? Maybe something should be done?

    What are all the things that can possibly be wrong with me?

    THIS IS EVERYTHING THAT HAS HAPPENED TO ME SINCE 2007 AND ITS

    JUST A VERY SHORT SUMMERY

    I have had irregular periods ever since I had my first one back in 2007. That first year I had it, It started in January, only lasted 3 days, a short period. Then I would have it every 2-3 months just 4 days maybe. That same year I had it in july and it lasted till the end of august. I didn't get another till december. That was a 5 day period and then I skipped about 5 months before i got another one in april. That one was also normal. July 2008 I got my period again for about 2 weeks. I didn't get one till november which was normal as well. Then in 2009 for 6 months starting from january, I had my period till the beginning of June. I didn't get one again till september and that one lasted until the end of october. After that I got my period again in January(2010, this year) I think it was the 3th of January and It hasn't stopped yet. I have done my research about irregular periods and Ive hear about many things you can get, but I don't know at all. My doctor recommended that I take a birth control. But I have refused because I think that my parents and grandparents would all freak out. Also considering the fact that everyone in my family never took birth control.The next thing my doctor wanted to do was blood tests. I also refused because I hate blood tests personally.

    If you need anymore information:

    - I just turned 16 this past saturday

    - I never got any cramps until just today, it was pretty bad, It

    actually hurt so much I cried today in school while taking a

    test

    -Another thing is also of bleeding in the past 5 days or so. I

    have been wearing a tampon and a pad for the past almost

    week

    What I'm asking:

    What can be wrong with me?or in other words

    Whats making these periods to last so long?

    *****PLEASE ANSWER MY QUESTION AND YOU

    MAY ADD MORE DETAIL TO EXPLAIN YOUR ANSWER*****

    2 AnswersWomen's Health1 decade ago
  • I cant explain this, I am still shaking....?

    Help me.

    guys you shouldn't be answering this

    question at all unless your a doctor

    because I doubt you would know it, NO

    OFFENSE!

    This morning I woke up feeling happy and not expecting

    anything to go wrong(because its my birthday) and I go to

    the bathroom to find that my period(that has been going

    on since January) just started getting very heavy in the last

    week or so. My tampon was completely bloody as well as

    parts of my underwear. I was to scared to pull out the tampon

    and then once i did, this huge blob slipped out with it. I was

    shaking. It was red, gooey, and i don't think that's supposed

    to happen when you pull it out. I am still shaking because it

    was pretty big and i cant explain what had happened.

    Ive had my period since January and its probably because

    of a hormone imbalance, so i will have to be taking birth

    control to control it eventually, that's what my doctor said

    And lastly my period never was heavy it went very light for

    all these past months and stop maybe 2 days in one week,

    then continued through the next then another 2 day stop, you

    get it?

    PLEASE ANSWER MY QUESTION AND ANSWER IT WELL, IF YOU

    WANT TO EXPLAIN MORE OF WHY THIS IS HAPPENING I WOULD

    SERIOUSLY APPRECIATE IT!!!

    3 AnswersOther - Health1 decade ago